Review



t5 caption a7 strains relevant characteristics source  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    ATCC t5 caption a7 strains relevant characteristics source
    T5 Caption A7 Strains Relevant Characteristics Source, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 2869 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/A7/pmc05585069-83-17-32
    Average 96 stars, based on 2869 article reviews
    t5 caption a7 strains relevant characteristics source - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: The two-component system VicRK regulates functions associated with Streptococcus mutans resistance to complement immunity
    Article Snippet: Erythromycin (10 μg/ml) and spectinomycin (200 μg/ml) (Merck Labs, Germany) were added to growth medium for maintenance of mutant and complemented strains, respectively. .. Oligonucleotides used for construction of mutants and transcriptional analyses are shown in . table ft1 table-wrap mode="anchored" t5 caption a7 Strains Relevant characteristics Source or reference UA159 Erm s , Spec s ATCC UAvic Δ vicK ::Erm r 9 UAsmaA Δ smaA ::Erm r 10 UA2146c Δ smu.2146c ::Erm r 10 UA399 Δ smu.399 ::Erm r This study UApepO ΔpepO::Erm r This study UAvic+ UAvic with pDL278:: SMU.1516 ; Spec r 9 UAsmaA+ UAsmaA with pDL278:: smu.609 ; Spec r 10 UA2146c+ UA2146c with pDL278:: smu.2146c ; Spec r 10 UA399+ UA399 with pDL278:: smu.399 ; Spec r This study UApepO+ UA2146c with pDL278:: smu.2146c ; Spec r This study Open in a separate window Strains used in this study table ft1 table-wrap mode="anchored" t5 caption a7 Primer Name Sequence 5′-3′ Product size (bp) Source 16SRNAF 16SRNAR CGGCAAGCTAATCTCTGAAA GCCCCTAAAAGGTTACCTCA 190 17 smu360F smu360R CCTAACTCAACTGGTGCTGCT CAGCATTCACTTCATCAACAG 161 This study smu630F smu630R AGAATGGATGCTCTTGGCTTA GCTGTCATAGGCTGTGTTTCA 170 This study smu676F smu676R TCGTATGGAAGGTGAAGTC GTAAGAGCCCTGAGATTGAT 218 This study smu2036F smu2036R TACCCATAGCTTGAGGTGT ACACCAGAACTGCCTTTAG 253 This study smu399F smu399R GATTGAAGAGTCACCGGATA CCGCTTGTTTAGTCTCTTGA 242 This study smu1247F smu1247R GACTTCTTCACCTGGTTTG CTCACTCAGATGCTCCAAT 251 This study smu609F smu609R GGCACAAGGAACCTATCACTTT GCTTTCCAATAACAACATAACGAC 191 10 smu2146F smu2146R AATCTGTTCTTGCTCACACTGC ACATTATCAGTTGGTTCAGTTGCT 145 10 smu2147cF smu2147cR TTATCAGAGATTGCTTCAACACA CTGAGGTTTCTGCTTCATTTATC 175 10 ermE1-AscI ermE2-XhoI TT GGCGCGCC TGGCGGAAACGTAAAAGAAG TT CTCGAGG GCTCCTTGGAAGCTGTCAGT 998 10 smu.399P1 smu.399P2-AscI TCTTCTTCACCATTTCTTGC TT GGCGCGCC CGGTGACTCTTCAATCAAAA 496 This study smu.399P3-XhoI smu.399P4 TT CTCGAG TGTTGAGAGTCATGGAGAGG AAAGCTGCCTGATGGTTACT 505 This study smu.2036P1 smu.2036P2-AscI TTTACTATCGGCGCTAAGGT TT GGCGCGCC ACTGTTTCGGAAAATGTGG 501 This study smu.2036P3-XhoI smu.2036P4 TT CTCGAG GACGATGGAACTTCACAAAA GATCAAAGGCAATTTACGGG 490 This study smu.399C1-PvuI smu.399C2-BamHI GG CGATCG TGGATGTTACGTGGACTGT GG GGATCC GGCCATCATAAAGTGCTAAA 1,883 This study smu.2036C1-BamHI smu.2036C2-SphI GG GGATCC ATGCCGCTAATTGCTCAAG GG GCATGC AGTCAATGAAAAAACGCTTGA 2,750 This study Open in a separate window a Underlined sequences indicate restriction enzyme linkers. .. Oligonucleotides used in this study Volunteers, sera and blood samples Blood samples were collected by venipuncture in heparin vacuum tubes (BD Vacutainer ® ) from six health subjects (three males, three females; mean age of 30 years, range 25 to 45 years), who were enrolled in a previous study 3 , according to standard protocols previously approved by the Ethical Committee of the Piracicaba Dental School, State University of Campinas (proc. n° 031/2012).



    Similar Products

    96
    ATCC t5 caption a7 strains relevant characteristics source
    T5 Caption A7 Strains Relevant Characteristics Source, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/A7/pmc05585069-83-17-32
    Average 96 stars, based on 1 article reviews
    t5 caption a7 strains relevant characteristics source - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    ATCC t5 caption a7 strain relevant characteristics source
    T5 Caption A7 Strain Relevant Characteristics Source, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/A7/pmc03486046-110-24-37
    Average 96 stars, based on 1 article reviews
    t5 caption a7 strain relevant characteristics source - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    ATCC t5 caption a7 strain relevant characteristic s source swarming surfactant ∗ s marcescens 274 wt s marcescens atcc † rh1041 serrawettin mutant
    Strains used in this study
    T5 Caption A7 Strain Relevant Characteristic S Source Swarming Surfactant ∗ S Marcescens 274 Wt S Marcescens Atcc † Rh1041 Serrawettin Mutant, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/A7/pmc03164129-52-50-68
    Average 96 stars, based on 1 article reviews
    t5 caption a7 strain relevant characteristic s source swarming surfactant ∗ s marcescens 274 wt s marcescens atcc † rh1041 serrawettin mutant - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    ATCC t5 caption a7 strain plasmid relevant characteristics source treponema denticola atcc 35405 type strain
    (A) Predicted identifiable peptide motifs (www.ebi.ac.uk/InterProScan/) of Treponema pallidum fibronectin-binding protein Tp0155 and potential orthologues identified from the Treponema denticola genome using BLAST similarity searches. LysM domains are shown with vertical bars (A) or dots (B). Treponema pallidum and T. denticola M23 peptidase domains (diagonal bars) retain 37% identity. Potential signal sequences (solid black) were identified using http://bioinformatics.leeds.ac.uk/prot_analysis/signal.html. (B) Alignments of LysM(A) and LysM(B) domain sequences from T. pallidum Tp0155 and potential T. denticola orthologues showing high degree of consensus across the different peptide sequences. Degree of identity is shown from highest (e.g. 
) to lowest (e.g. H). The LysM motif YxxxxGxx(Hyd) (Turner et al., 2004) is boxed. Asterisk indicates residues that do not fit the specified motif.
    T5 Caption A7 Strain Plasmid Relevant Characteristics Source Treponema Denticola Atcc 35405 Type Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/Plasmid/pmc03103763-139-38-47
    Average 99 stars, based on 1 article reviews
    t5 caption a7 strain plasmid relevant characteristics source treponema denticola atcc 35405 type strain - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    ATCC t5 caption a7 e coli strain relevant characteristics source
    Anaerobic xylitol production in engineered <t>E.</t> <t>coli.</t> Glucose conversion to acetate serves as the source of reducing power for xylose reduction to xylitol by heterologously expressed, NADPH-dependent xylose reductase (CbXR). Reducing equivalents are transferred from NADH to NADP+ in a reaction catalyzed by the native pyridine nucleotide transhydrogenase PntAB. Xylose reduction to xylitol serves as the primary means of NAD(P)H reoxidation and maintenance of intracellular redox balance.
    T5 Caption A7 E Coli Strain Relevant Characteristics Source, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t5+caption+a7+strains+relevant+characteristics+source/Escherichia+coli+bacteriophage+T5/pmc03020535-48-27-41
    Average 94 stars, based on 1 article reviews
    t5 caption a7 e coli strain relevant characteristics source - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Strains used in this study

    Journal: Biophysical Journal

    Article Title: Collective Motion of Surfactant-Producing Bacteria Imparts Superdiffusivity to Their Upper Surface

    doi: 10.1016/j.bpj.2011.07.019

    Figure Lengend Snippet: Strains used in this study

    Article Snippet: Of the three B. subtilis motility mutants, DS1677 is nonmotile, because it lacks the flagellar filament gene hag ; DS90 is motile and swarming-proficient but its flagellar motors are counterclockwise (CCW)-biased; and DS73 is motile but swarming-defective because its motors are clockwise (CW)-biased ( 18 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain Relevant characteristic(s) Source Swarming Surfactant ∗ S. marcescens 274 WT S. marcescens + + ATCC † RH1041 Serrawettin mutant of S. marcescens 274 + — ( 31 ) ‡ S. mar A WT S. marcescens + + UT Austin § B. subtilis 3610 WT Bacillus subtilis + + Daniel Kearns ¶ DS1677 B. subtilis 3610 Δ hag — + Daniel Kearns ¶ DS73 B. subtilis 3610 cheA :: tet ‖ — + Daniel Kearns ¶ DS90 B. subtilis 3610 cheB :: tet + + Daniel Kearns ¶ AW405 Motile E. coli K12 + — Julius Adler ∗∗ RP437 Motile E. coli K12 + — John S. Parkinson †† Open in a separate window ∗ The surfactants made by Serratia and Bacillus strains are serrawettin and surfactin, respectively.

    Techniques: Mutagenesis

    (A) Predicted identifiable peptide motifs (www.ebi.ac.uk/InterProScan/) of Treponema pallidum fibronectin-binding protein Tp0155 and potential orthologues identified from the Treponema denticola genome using BLAST similarity searches. LysM domains are shown with vertical bars (A) or dots (B). Treponema pallidum and T. denticola M23 peptidase domains (diagonal bars) retain 37% identity. Potential signal sequences (solid black) were identified using http://bioinformatics.leeds.ac.uk/prot_analysis/signal.html. (B) Alignments of LysM(A) and LysM(B) domain sequences from T. pallidum Tp0155 and potential T. denticola orthologues showing high degree of consensus across the different peptide sequences. Degree of identity is shown from highest (e.g. 
) to lowest (e.g. H). The LysM motif YxxxxGxx(Hyd) (Turner et al., 2004) is boxed. Asterisk indicates residues that do not fit the specified motif.

    Journal: Molecular oral microbiology

    Article Title: Characterization of a novel family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola

    doi: 10.1111/j.2041-1014.2010.00584.x

    Figure Lengend Snippet: (A) Predicted identifiable peptide motifs (www.ebi.ac.uk/InterProScan/) of Treponema pallidum fibronectin-binding protein Tp0155 and potential orthologues identified from the Treponema denticola genome using BLAST similarity searches. LysM domains are shown with vertical bars (A) or dots (B). Treponema pallidum and T. denticola M23 peptidase domains (diagonal bars) retain 37% identity. Potential signal sequences (solid black) were identified using http://bioinformatics.leeds.ac.uk/prot_analysis/signal.html. (B) Alignments of LysM(A) and LysM(B) domain sequences from T. pallidum Tp0155 and potential T. denticola orthologues showing high degree of consensus across the different peptide sequences. Degree of identity is shown from highest (e.g. ) to lowest (e.g. H). The LysM motif YxxxxGxx(Hyd) (Turner et al., 2004) is boxed. Asterisk indicates residues that do not fit the specified motif.

    Article Snippet: The E. coli was cultured on Luria Bertani (LB) agar ( Sambrook et al ., 1989 ) or in LB broth, containing appropriate antibiotics (ampicillin, 100μg ml −1 ; kanamycin 25μg ml −1 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain/plasmid Relevant characteristics Source Treponema denticola ATCC 35405 Type strain ( Chan et al ., 1993 ) Escherichia coli XL-1 Blue recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac [ F ‘proAB lacl q Z Δ M15 Tn10 (Tet R )] Stratagene M15 (pREP-4 Kn R ) nal s str s rif s thi − lac − ara + gal + mtl − F − recA + uvr + lon + Qiagen Plasmids pQE30 bla ColE1 ori (Ap R ) Qiagen pQE30-TDE2318 bla ColE1 ori This study pQE30-TDE2753 bla ColE1 ori This study pQE30-TDE1738 bla ColE1 ori This study pQE30-TDE0110 bla ColE1 ori This study pQE30-TDE2189 bla ColE1 ori This study pQE30-TDE1136 bla ColE1 ori This study pQE30-TDE1297 bla ColE1 ori This study Open in a separate window Bacterial strains and plasmids used in this study

    Techniques: Binding Assay

    Detection of proteins on the surface of Treponema denticola ATCC 35405 using antibodies to the Treponema pallidum protein Tp0155 which had first been pre-adsorbed against Treponema phagedenis (Kazan). (A, C, E, G, I, K and M) Phase-contrast images; (B, D, F, H, J, L and N) corresponding immunofluorescence. (A, B) Preimmune serum for Tp0155-specific antibodies; (C, D), Tp0155-specific antibodies, non-detergent-treated T. denticola; (E, F), Tp0155-specific antibodies, Triton X-114-treated T. denticola; (G, H), preimmune serum for Tp0249-specific antibodies; (I, J), Tp0249-specific antibodies, non-detergent-treated T. denticola (negative control); (K, L), Tp0249-specific antibodies, Triton X-114-treated T. denticola; (M, N), anti-T. denticola antibodies (control) (Edwards et al., 2005).

    Journal: Molecular oral microbiology

    Article Title: Characterization of a novel family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola

    doi: 10.1111/j.2041-1014.2010.00584.x

    Figure Lengend Snippet: Detection of proteins on the surface of Treponema denticola ATCC 35405 using antibodies to the Treponema pallidum protein Tp0155 which had first been pre-adsorbed against Treponema phagedenis (Kazan). (A, C, E, G, I, K and M) Phase-contrast images; (B, D, F, H, J, L and N) corresponding immunofluorescence. (A, B) Preimmune serum for Tp0155-specific antibodies; (C, D), Tp0155-specific antibodies, non-detergent-treated T. denticola; (E, F), Tp0155-specific antibodies, Triton X-114-treated T. denticola; (G, H), preimmune serum for Tp0249-specific antibodies; (I, J), Tp0249-specific antibodies, non-detergent-treated T. denticola (negative control); (K, L), Tp0249-specific antibodies, Triton X-114-treated T. denticola; (M, N), anti-T. denticola antibodies (control) (Edwards et al., 2005).

    Article Snippet: The E. coli was cultured on Luria Bertani (LB) agar ( Sambrook et al ., 1989 ) or in LB broth, containing appropriate antibiotics (ampicillin, 100μg ml −1 ; kanamycin 25μg ml −1 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain/plasmid Relevant characteristics Source Treponema denticola ATCC 35405 Type strain ( Chan et al ., 1993 ) Escherichia coli XL-1 Blue recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac [ F ‘proAB lacl q Z Δ M15 Tn10 (Tet R )] Stratagene M15 (pREP-4 Kn R ) nal s str s rif s thi − lac − ara + gal + mtl − F − recA + uvr + lon + Qiagen Plasmids pQE30 bla ColE1 ori (Ap R ) Qiagen pQE30-TDE2318 bla ColE1 ori This study pQE30-TDE2753 bla ColE1 ori This study pQE30-TDE1738 bla ColE1 ori This study pQE30-TDE0110 bla ColE1 ori This study pQE30-TDE2189 bla ColE1 ori This study pQE30-TDE1136 bla ColE1 ori This study pQE30-TDE1297 bla ColE1 ori This study Open in a separate window Bacterial strains and plasmids used in this study

    Techniques: Immunofluorescence, Negative Control, Control

    (A) Alignments of M23 peptidase domains from TDE1738 of Treponema denticola and homologous regions of peptidoglycan-degrading enzymes lysostaphin from Staphylococcus simulans biovar staphylolyticus, zoocin A from Streptococcus equi subsp zooepidemicus and ALE-1 from Staphylococcus capitis. The M23 peptidase domain of TDE1738 retains 43% identity to lysostaphin, 43% identity to zoocin A and 40% identity to ALE-1 with conservation across the HxGxD and HLH active sites. (B) Alignments of a 92 amino acid (aa) residue portion regions of TDE1739 of T. denticola and lysostaphin immunity factor from S. simulans biovar staphylolyticus, demonstrating homology (29% identity) between these peptides. Sequence consensus is shown as is degree of identity from highest (e.g. 
) to lowest (e.g. A). (C) Diagram depicting genes encoding potential and known peptidoglycan degradation enzymes and adjacent immunity factors which provide protection from autolysis by the peptidoglycanolytic enzyme. (i) The chromosomal gene TDE1738 from T. denticola encodes for a potential peptidoglycan-degrading enzyme, and TDE1739 for a potential immunity factor. (ii) Lysostaphin and adjacent lysostaphin immunity factor (Lif/Epr) are encoded on the plasmid pACK1 of S. simulans biovar staphylolyticus. (iii) The gene encoding zoocin A and corresponding zoocin A immunity factor (Zif) is on the chromosome of Streptococcus equi subsp zooepidemicus, while (iv) ale-1 and adjacent endopeptidase resistance (epr) genes are located on a plasmid in Staphylococcus capitis. (v) Tp0706 from the Treponema pallidum chromosome, with homology to TDE1738 may also be an enzyme with peptidoglycan-degrading activity and the adjacent gene Tp0705 is annotated as a pencillin-binding protein in the same manner as zoocin A immunity factor (Zif).

    Journal: Molecular oral microbiology

    Article Title: Characterization of a novel family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola

    doi: 10.1111/j.2041-1014.2010.00584.x

    Figure Lengend Snippet: (A) Alignments of M23 peptidase domains from TDE1738 of Treponema denticola and homologous regions of peptidoglycan-degrading enzymes lysostaphin from Staphylococcus simulans biovar staphylolyticus, zoocin A from Streptococcus equi subsp zooepidemicus and ALE-1 from Staphylococcus capitis. The M23 peptidase domain of TDE1738 retains 43% identity to lysostaphin, 43% identity to zoocin A and 40% identity to ALE-1 with conservation across the HxGxD and HLH active sites. (B) Alignments of a 92 amino acid (aa) residue portion regions of TDE1739 of T. denticola and lysostaphin immunity factor from S. simulans biovar staphylolyticus, demonstrating homology (29% identity) between these peptides. Sequence consensus is shown as is degree of identity from highest (e.g. ) to lowest (e.g. A). (C) Diagram depicting genes encoding potential and known peptidoglycan degradation enzymes and adjacent immunity factors which provide protection from autolysis by the peptidoglycanolytic enzyme. (i) The chromosomal gene TDE1738 from T. denticola encodes for a potential peptidoglycan-degrading enzyme, and TDE1739 for a potential immunity factor. (ii) Lysostaphin and adjacent lysostaphin immunity factor (Lif/Epr) are encoded on the plasmid pACK1 of S. simulans biovar staphylolyticus. (iii) The gene encoding zoocin A and corresponding zoocin A immunity factor (Zif) is on the chromosome of Streptococcus equi subsp zooepidemicus, while (iv) ale-1 and adjacent endopeptidase resistance (epr) genes are located on a plasmid in Staphylococcus capitis. (v) Tp0706 from the Treponema pallidum chromosome, with homology to TDE1738 may also be an enzyme with peptidoglycan-degrading activity and the adjacent gene Tp0705 is annotated as a pencillin-binding protein in the same manner as zoocin A immunity factor (Zif).

    Article Snippet: The E. coli was cultured on Luria Bertani (LB) agar ( Sambrook et al ., 1989 ) or in LB broth, containing appropriate antibiotics (ampicillin, 100μg ml −1 ; kanamycin 25μg ml −1 ). table ft1 table-wrap mode="anchored" t5 caption a7 Strain/plasmid Relevant characteristics Source Treponema denticola ATCC 35405 Type strain ( Chan et al ., 1993 ) Escherichia coli XL-1 Blue recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac [ F ‘proAB lacl q Z Δ M15 Tn10 (Tet R )] Stratagene M15 (pREP-4 Kn R ) nal s str s rif s thi − lac − ara + gal + mtl − F − recA + uvr + lon + Qiagen Plasmids pQE30 bla ColE1 ori (Ap R ) Qiagen pQE30-TDE2318 bla ColE1 ori This study pQE30-TDE2753 bla ColE1 ori This study pQE30-TDE1738 bla ColE1 ori This study pQE30-TDE0110 bla ColE1 ori This study pQE30-TDE2189 bla ColE1 ori This study pQE30-TDE1136 bla ColE1 ori This study pQE30-TDE1297 bla ColE1 ori This study Open in a separate window Bacterial strains and plasmids used in this study

    Techniques: Residue, Sequencing, Plasmid Preparation, Activity Assay, Binding Assay

    Anaerobic xylitol production in engineered E. coli. Glucose conversion to acetate serves as the source of reducing power for xylose reduction to xylitol by heterologously expressed, NADPH-dependent xylose reductase (CbXR). Reducing equivalents are transferred from NADH to NADP+ in a reaction catalyzed by the native pyridine nucleotide transhydrogenase PntAB. Xylose reduction to xylitol serves as the primary means of NAD(P)H reoxidation and maintenance of intracellular redox balance.

    Journal: Applied and Environmental Microbiology

    Article Title: Anaerobic Obligatory Xylitol Production in Escherichia coli Strains Devoid of Native Fermentation Pathways ▿

    doi: 10.1128/AEM.01890-10

    Figure Lengend Snippet: Anaerobic xylitol production in engineered E. coli. Glucose conversion to acetate serves as the source of reducing power for xylose reduction to xylitol by heterologously expressed, NADPH-dependent xylose reductase (CbXR). Reducing equivalents are transferred from NADH to NADP+ in a reaction catalyzed by the native pyridine nucleotide transhydrogenase PntAB. Xylose reduction to xylitol serves as the primary means of NAD(P)H reoxidation and maintenance of intracellular redox balance.

    Article Snippet: Subsequent strains were created via phage P1 transductions followed by flippase recombinase-mediated excision of the corresponding antibiotic resistance marker gene ( 8 ). table ft1 table-wrap mode="anchored" t5 caption a7 E. coli strain Relevant characteristics Source or reference W3110 Wild type ATCC 27325 JC11 W3110, Δ xylB ::FRT HK022::( CbXR- FRT) Chin and Cirino, submitted OA126 JC11, Δ ldhA ::FRT Δ adhE ::FRT Δ frdA ::FRT This study YK87 a W3110, Δ ldhA Δ( focA-pflB )::FRT Δ adhE FRT -kan- FRT lpd101 (E354K) 14 OA87 YK87 Δ xylAB ::FRT Δ frdA ::FRT HK022::( CbXR- FRT) This study OA176 b OA87, Δ( zwf - eda )::FRT This study OA163 OA87, Δ sthA ::FRT This study OA120 OA87, Δ pntA ::FRT This study OA207 OA120, Δ sthA ::FRT This study OA205 OA176, Δ pntA ::FRT This study Open in a separate window a Strain YK87 was a gift from K. T. Shanmugam (University of Florida). b The zwf , edd , and eda genes were deleted in strain OA176.

    Techniques:

    E. coli central pathways and fermentation products. The Embden-Meyerhof-Parnas (EMP), pentose phosphate (PP), and Entner-Doudoroff (ED) pathways convert glucose-6-phosphate ultimately to pyruvate. The PP and ED pathways branch from glucose-6-phosphate and re-enter glycolysis at different locations. The molar yields of ATP (denoted as n) and NAD(P)H (denoted as m) per glucose depend on the pathway used in glucose oxidation. The EMP pathway generates the most ATP (nEMP = 2 for conversion of 1 mole of glucose to 2 moles of pyruvate), with a corresponding mEMP of 2 (16). Major fermentation products obtained from the central pathways are shown in boxes. Dashed arrows indicate multistep reactions. Abbreviations: glucose-6-P, glucose-6-phosphate; Glc-PTS, glucose phosphotransferase system; PEP, phosphoenolpyruvate; PYR, pyruvate; Zwf, glucose-6-phosphate dehydrogenase; Pgi, phosphoglucoisomerase; Edd, 6-phosphogluconate dehydratase; Eda, 2-keto-3-deoxy-6-phosphogluconate aldolase; FrdA, flavoprotein of the fumarate reductase enzyme complex; LdhA, lactate dehydrogenase; PflB, subunit of the pyruvate-formate lyase; PDHc, pyruvate dehydrogenase enzyme complex; AdhE, alcohol dehydrogenase; CoA, coenzyme A.

    Journal: Applied and Environmental Microbiology

    Article Title: Anaerobic Obligatory Xylitol Production in Escherichia coli Strains Devoid of Native Fermentation Pathways ▿

    doi: 10.1128/AEM.01890-10

    Figure Lengend Snippet: E. coli central pathways and fermentation products. The Embden-Meyerhof-Parnas (EMP), pentose phosphate (PP), and Entner-Doudoroff (ED) pathways convert glucose-6-phosphate ultimately to pyruvate. The PP and ED pathways branch from glucose-6-phosphate and re-enter glycolysis at different locations. The molar yields of ATP (denoted as n) and NAD(P)H (denoted as m) per glucose depend on the pathway used in glucose oxidation. The EMP pathway generates the most ATP (nEMP = 2 for conversion of 1 mole of glucose to 2 moles of pyruvate), with a corresponding mEMP of 2 (16). Major fermentation products obtained from the central pathways are shown in boxes. Dashed arrows indicate multistep reactions. Abbreviations: glucose-6-P, glucose-6-phosphate; Glc-PTS, glucose phosphotransferase system; PEP, phosphoenolpyruvate; PYR, pyruvate; Zwf, glucose-6-phosphate dehydrogenase; Pgi, phosphoglucoisomerase; Edd, 6-phosphogluconate dehydratase; Eda, 2-keto-3-deoxy-6-phosphogluconate aldolase; FrdA, flavoprotein of the fumarate reductase enzyme complex; LdhA, lactate dehydrogenase; PflB, subunit of the pyruvate-formate lyase; PDHc, pyruvate dehydrogenase enzyme complex; AdhE, alcohol dehydrogenase; CoA, coenzyme A.

    Article Snippet: Subsequent strains were created via phage P1 transductions followed by flippase recombinase-mediated excision of the corresponding antibiotic resistance marker gene ( 8 ). table ft1 table-wrap mode="anchored" t5 caption a7 E. coli strain Relevant characteristics Source or reference W3110 Wild type ATCC 27325 JC11 W3110, Δ xylB ::FRT HK022::( CbXR- FRT) Chin and Cirino, submitted OA126 JC11, Δ ldhA ::FRT Δ adhE ::FRT Δ frdA ::FRT This study YK87 a W3110, Δ ldhA Δ( focA-pflB )::FRT Δ adhE FRT -kan- FRT lpd101 (E354K) 14 OA87 YK87 Δ xylAB ::FRT Δ frdA ::FRT HK022::( CbXR- FRT) This study OA176 b OA87, Δ( zwf - eda )::FRT This study OA163 OA87, Δ sthA ::FRT This study OA120 OA87, Δ pntA ::FRT This study OA207 OA120, Δ sthA ::FRT This study OA205 OA176, Δ pntA ::FRT This study Open in a separate window a Strain YK87 was a gift from K. T. Shanmugam (University of Florida). b The zwf , edd , and eda genes were deleted in strain OA176.

    Techniques: